Коронавирус COVID-19 (SARS-CoV-2): обнаружение и характеризация вакцин, Merck

Предлагаем подробный обзор продуктов и услуг компании Merck для исследователей COVID-19. Реактивы для очистки НК, проведения ПЦР, иммунологического анализа, антитела, мультиплексный анализ Milliplex и многое другое.

Обнаружение вирусов

Предлагаем ознакомиться с предлагаемым ассортиментом продуктов для очистки вирусной РНК, проведения ОТ-ПЦР, количественной ОТ-ПЦР, иммунологического анализа, а также вспомогательных реагентов, которые помогут в разработке аналитических методик для диагностики SARS-CoV-2.

Ознакомьтесь с полным обзором решений Merck для разработки диагностических методик иммунологического и молекулярного анализа.

Наборы и реагенты для количественного ПЦР-определения коронавируса 2019-nCoV

Наборы для количественного ПЦР-определения коронавируса 2019-nCoV (SARS-CoV-2), представленные ниже в продуктовой линейке KiCqStart, доступны для заказа уже сейчас.


Ниже приведён перечень доступных целевых структур для обнаружения

Детектирующая
структура
Прямая последовательность Обратная последовательность Зонд
SYBR Green 1 GCCTCTTCTCGTTCCTCATCAC AGCAGCATCACCGCCATTG
SYBR Green 2 AGCCTCTTCTCGTTCCTCATCAC CCGCCATTGCCAGCCATTC
Двояко-меченый зонд 1 CCGCAAGGTTCTTCTTCGTAAG TGCTATGTTTAGTGTTCCAGTTTTC AAGGATCAGTGCCAAGCTCGTCGCC
Двояко-меченый зонд 2 GGCTTACCGCAAGGTTCTTC TGCTATGTTTAGTGTTCCAGTTTTC AAGGATCAGTGCCAAGCTCGTCGCC
Двояко-меченый зонд 3 CAGGTATATGCGCTAGTTATCAGAC CCAAGTGACATAGTGTAGGCAATG AGACTAATTCTCCTCGGCGGGCACG
Двояко-меченый зонд 4 GCAGGTATATGCGCTAGTTATCAG ACACTGGTAGAATTTCTGTGGTAAC AGACTAATTCTCCTCGGCGGGCACG


Ниже приведена структура для положительного контроля при обнаружении SARS (на данный момент методика прошла валидацию in silico)

Детектирующая
структура
Прямая последовательность Обратная последовательность Зонд
Двояко-меченый зонд GCTGTGTGTTTGCCTATGTTGG ACGTTCACGACTCAGTATCTCAAG AGCGTGCCTACTGGGTTCCTCGTGC


ОТ-ПЦР и количественная ОТ-ПЦР: молекулярный анализ и вспомогательные реагенты

Merck предлагает широкий ассортимент реагентов, наборов и инструментов для проведения ПЦР, способных удовлетворить Ваши потребности на любой стадии разработки методик определения SARS-CoV-2.

  • Набор Transcriptor One-Step RT-PCR для проведенияОТ-ПЦР
  • Набор Transcriptor One-Step RT-PCR разработан с применением инновационной
  • технологии одностадийной полимеразной цепной реакции с
  • обратной транскрипцией (ОТ-ПЦР). Смесь ферментов, входящая
  • в комплект, содержит Taq ДНК-полимеразу и корректирующую
  • полимеразу, обеспечивающие высокую чувствительность
  • и надёжность результатов обратной транскрипции. Набор
  • Transcriptor One-Step RT-PCR содержит все необходимые
  • компоненты (за исключением матриц и праймеров) для
  • проведения одностадийной ОТ-ПЦР.

  • KAPA PROBE FAST One-Step
    Набор KAPA PROBE FAST One-Step разработан для быстрого высокоэффективного одностадийного количественного определения РНК. Набор KAPA PROBE FAST One-Step пригоден для использования в сочетании с любыми флуорогеннымизондами, включая гибридизационные зонды (например, FRET), гидролизуемые зонды (например, TaqMan) и зонды-молекулярные маяки.

  • Система Titan One Tube RT-PCR
    При проведении ПЦР в системе Titan One Tube RT-PCR синтез первой цепочки кДНК осуществляется с помощью обратной транскриптазы вируса миелобластоза птиц (AMV), а последующая амплификация кДНК — с помощью смеси ферментов Expand High Fidelity, в состав которой входят ДНК-полимераза Taq и корректирующая полимераза.

  • Комплект Quantitative RT-PCR ReadyMix для проведения количественной ОТ-ПЦР
    Помимо обратной транскриптазы вируса мышиного лейкоза Молони (M-MLV RT), которая участвует в синтезе первой цепочки кДНК, набор ReadyMix™ для количественной ОТ-ПЦР содержит также растворы ДНК-полимеразы JumpStart Taq DNA, дезоксинуклеотиды 99% чистоты, а также буферные растворы и стабилизаторы, поставляемые в виде растворов двойной концентрации.

  • Комплект KiCqStart One-Step Probe RT-qPCR ReadyMix для проведения одностадийной количественной ОТ-ПЦР с использованием зондов
    Набор KiCqStart One-Step Probe RT-qPCR ReadyMix подходит для работы со всеми типами двояко-меченых зондов и содержит все необходимые реагенты (за исключением матриц РНК и зондов) для проведения количественной ОТ-ПЦР. Возможна поставка комплекта KiCqStartOne-Step Probe RTqPCR ReadyMix с референсным красителем ROX или без него.

  • Комплект SYBR Green Quantitative RT-qPCR для количественной ОТ-ПЦР
    Данный набор, сочетающий в себе преимущества обратной транскриптазы вируса мышиного лейкоза Молони (M-MLV RT) и ДНК-полимеразы JumpStart Taq DNA, входящих в состав удобной в работе смеси ReadyMix, позволяет проводить высокочувствительный количественный анализ экспрессии генов.

Описание № в каталоге

Transcriptor One-Step RT-PCR Kit

TOSRTRO

KAPA PROBE FAST One-Step

KK4752

Titan One Tube RT-PCR System

11855476001

Quantitative RT-PCR ReadyMix

QR0200

KiCqStart One-Step Probe RT-qPCR ReadyMix

KCQS07

KiCqStart One-Step Probe RT-qPCR ReadyMix, Low ROX

KCQS08

KiCqStart One-Step Probe RT-qPCR ReadyMix, ROX

KCQS09

Nuclease-Free Water, Molecular Grade

W4502

SYBR Green Quantitative RT-qPCR

QR0100

NucleoClean Decontamination Spray (alternative to bleach)

3097S

ViralXress DNA/RNA Extraction Reagent

3095

Nuclease Free Water

3098


Продукты предназначены только для исследовательских целей. Не использовать для диагностики.

Сверхчистая вода

Высокая скорость развития и возрастающее разнообразие исследовательских работ, постоянная смена приоритетов, большое число операторов и ограниченность пространства — все эти факторы стимулируют лаборатории к приобретению универсального, инновационного и удобного в размещении оборудования. Cистема получения сверхчистой воды Milli-Q IQ 7000 с различными финишными фильтрами соответствует всем перечисленным требованиям.

Основные продукты для разработки методик молекулярной диагностики и иммунологического анализа

Антитела для разработки методик серологического анализа. Линейка антител Merck подходит для классификации человеческих иммуноглобулинов (IgG, IgM, IgA), в цельной крови для разработки методик серологического анализа.


Описание № в каталоге

Goat Anti-Human IgG Antibody, HRP conjugate

AP112P

Goat Anti-Human IgG Antibody, HRP conjugate

AP309P

Anti-human IgM (μ-chain-specific) HRP

A6907

Anti-human IgA (α-chain-specific) HRP

A0295


Продукты предназначены только для исследовательских целей. Не использовать для диагностики.

Пробумин

Бычий сывороточный альбумин диагностического класса, применяемый в протеазочувствительном иммунологическом анализе и в качестве стабилизирующего агента для реагентов белковой природы, требующих низкого содержания IgG, также применяемый в молекулярной биологии. Чистота продукта превышает 98% и обычно равна 100%.

Описание Количество в упаковке № в каталоге

Probumin Bovine Serum Albumin

1 кг

820452

Probumin Bovine Serum Albumin

5 кг

820456

Probumin Bovine Serum Albumin

100 г

820451


Продукт предназначен для производственных и исследовательских целей. Продукт не предназначен для употребления в пищу человеком или животными. Не использовать для диагностики.

ProClin 300

Биоцид, разработанный для применения на предприятиях, занимающихся производством диагностических продуктов. Данный препарат является эффективной и безопасной для окружающей среды альтернативой для существующих консервантов, применяемых в реагентах для диагностики. При введении в рекомендованных количествах, препарат ProClin не представляет угрозы здоровью, не токсичен и не требует специальных мер по утилизации.

Описание № в каталоге

ProClin 300

48912-U


Характеризация вирусов

Разработка эффективных вакцин и лекарственных средств начинается с надёжной характеризации вируса. Здесь собраны сведения о реагентах и лабораторном оборудовании, предназначенных для исследования механизма прикрепления и проникновения вируса в клетку, вирусной геномики и протеомики, иммунного ответа. Представленные продукты обеспечивают безопасность и эффективность работы с вирусами и другими возбудителями.

Механизмы прикрепления и проникновения вируса в клетку

Недавние исследования механизма попадания вируса в клетку показали, что SARS-CoV-2 использует рецепторы ангиотензин-превращающего фермента II (ACE2) для попадания в клетку и сериновую протеазу TMPRSS2 для примирования S-белка. Используйте продукцию Merck для исследования моноклональных и поликлональных антител и низкомолекулярных веществ, специфичных для соответствующих вирусов, а также для исследования рецепторов, используемых вирусами для прикрепления и проникновения в клетки (включая ACE2).

Клеточные культуры для размножения вируса

Ассортимент клеточных культур, применяемых в исследовании механизма прикрепления вируса SARS CoV, его попадания в клетку и размножения, включает в себя клетки Vero, Huh-7D 12 и Caco-2. Все вариант доступны для заказа ниже.

Для получения информации об использовании клеточных культур для размножения вируса прочитайте статью «Использование клеточных культур для культивирования вирусов и производства вакцин».

Описание № в каталоге

Vero C1008 African green monkey kidney Cell LIne, Clone E6

85020206-1VL

Vero C1008 cell line [clone E6, Vero E6]

85020206

VeroCCL81 cell line

84113001

VeroCCL81 cell line (animal-component free)

08011101

16HBE14o- Human Bronchial Epithelial Cell Line

SCC150

CACO-2 Human Cell Line

86010202

CACO-2 Cell Line human (intestinal permeability characteristics tested)

09042001

Huh-7D12 Cell Line human (expresses ACE2 receptor)

01042712

293T cell line human

12022001

Human Small Airway Epithelial Cells (HSAEpC) Primary human cells (optimized media also available)

C-12642

Huh-7D 12 cell line, human

01042712-1VL

ACE2 Inhibitor, MLN-4760

5306160001

Angiotensin Converting Enzyme-2, ACE2

SAE0064

Anti SARS Antibody S-Specific Clone 154C

MAB8783

Anti-ACE2 antibody produced in rabbit, Prestige Antibodies (Enhanced Validation)
Immunogen:
ACE2 PrEST
Applications:
WB, IHC

HPA000288

Anti-ACE2 antibody produced in rabbit
Immunogen:
Synthetic peptide directed towards the middle region of human ACE2
Applications:
IF, IHC, ELISA, WB

SAB3500346

Anti-ACE2 antibody produced in rabbit
Immunogen:
Synthetic peptide directed towards the middle region of human ACE2
Applications:
WB, IHC

SAB2100025

Anti-ACE2 antibody produced in rabbit
Immunogen:
Synthetic peptide directed towards the N-terminus of human ACE2
Applications:
IF, IHC, ELISA, WB

SAB3500978

Anti-ACE2 antibody produced in rabbit
Immunogen:
Synthetic peptide directed towards the C-terminus of human ACE2
Applications:
IF, IHC, ELISA, WB

SAB3500977

Anti-ACE2 antibody, clone 4G5.1

MABN59

ANTI-BAT1(C-TERMINAL)

SAB1307254

Anti-CD209

SAB1407409

Anti-SARS Antibody, M Specific

MAB8787

Anti-TMPRSS2 antibody produced in rabbit, Prestige Antibodies

HPA035787


Анализ с проведением ОТ-ПЦР

Здесь собраны реагенты и инструменты для исследования генома вируса, включая наборы NAP для очистки вирусной РНК, высокоэффективные системы для ОТ-ПЦР и количественной ОТ-ПЦР, наборы для синтеза кДНК и многое другое. Наборы для одностадийного проведения анализа позволяют упростить и ускорить процедуру амплификации генов в широком динамическом диапазоне.
Описание № в каталоге

One Step RT-PCR Master Mix Kit

71978

Transcriptor One-Step RT-PCR Kit

TOSRTRO

Transcriptor High Fidelity cDNA Synthesis Kit

THIFICDNARO

Titan One Tube RT-PCR System

11855476001

KiCqStart One-Step Probe RT-qPCR ReadyMix

KCQS07

KAPA PROBE FAST One-Step

KK4752

M-MLV Reverse Transcriptase

M1302

RNAseZAP

R2020

SYBR Green JumpStart Taq ReadyMix

S4438

TRI reagent

T9424

SYBR Green Quantitative RT-qPCR Kit

QR0100

Quantitative RT-PCR ReadyMix

QR0200

Milli-Q IQ 7000 Water System

ZIQ7000T0

BioPak application pak

CDUFBI001


Инструменты для исследования вирусных белков

Гели и колонки для аффинной хроматографии, а также готовые к использованию буферные растворы для клеточного лизиса позволяют проводить быструю экстракцию вирусных белков для сокращения времени исследования и повышения точности результатов. Узнайте, как использовать метод вестерн-блоттинга для подтверждения результатов очистки вируса.
Недавно было установлено, что исследования белок-белковых взаимодействий имеют высокую важность для всестороннего изучения Covid-19. Для подтверждения протекания эндогенных белок-белковых взаимодействий можно использовать технологию Duolink PLA (метод близкого лигирования) с последующим считыванием результатов методом микроскопии или цитометрии в потоке.

Описание № в каталоге

HIS-Select Nickel Affinity Gel

P6611

Protein A-Sepharose

P3391

RIPA Buffer

R0278


Редактирование генов

Реагенты для нокаута или нокдауна генов рецептора ACE2 или иных генов, задействованных при поражении SARS-CoV-2 по технологии shRNA или CRISPR в плазмидном, лентивирусном или синтетическом формате.

Для получения более подробной информации о редактировании генов перейдите на страницу Merck, посвящённую достижениям геномики.

Библиотеки функциональной геномики CRISPR и RNAi для подбора инструментов для скрининга генов, делающих клетку более восприимчивой или устойчивой к инфицированию, репликации и развитию COVID-19, что позволяет разрабатывать генетические тесты, которые можно использовать в качестве вторичной диагностики при оценки риска осложнений COVID, а также риска инфицирования.

Иммунология

Иммунный ответ пациентов на коронавирусную инфекцию проявляется по-разному и может стать причиной неблагоприятного клинического исхода. Гипервоспалительный иммунный ответ способен привести к развитию «цитокинового шторма» (CSS), существенно усугубляющего течение болезни. Цитокины и мультиплексные панели Milliplex для обнаружения цитокинов / хемокинов дают исчерпывающую информацию о воспалительной реакции, развивающейся в тканях человека и приматов.
Описание № в каталоге

MILLIPLEX MAP Human Cytokine/Chemokine/Growth Factor Panel A - Immunology Multiplex Assay

HCYTA-60K

MILLIPLEX MAP Human Cytokine/Chemokine/Growth Factor Panel A 38 Plex Premixed Magnetic Bead Panel - Immunology Multiplex Assay

HCYTA-60K-PX38

MILLIPLEX MAP Human Cytokine/Chemokine/Growth Factor Panel A 38 Plex Premixed Magnetic Bead Panel – BULK (Space Saver) PACKAGING - Immunology Multiplex Assay

HCYTA-60K-PXBK38

MILLIPLEX MAP Human Cytokine/Chemokine/Growth Factor Panel A 48 Plex Premixed Magnetic Bead Panel - Immunology Multiplex Assay

HCYTA-60K-PX48

MILLIPLEX MAP Human Cytokine/Chemokine/Growth Factor Panel A 48 Plex Premixed Magnetic Bead Panel – BULK (Space Saver) PACKAGING - Immunology Multiplex Assay

HCYTA-60K-PXBK48

Раскрыть анкету для отправки заказа

Ваш заказ будет обработан
в ближайшее время.
Мы пришлем уведомление, как только все будет готово. Спасибо!